Transcriptional regulation of the Prevotella ruminicola recA gene

The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level. P. ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region.

At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents, mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress. No induction was detected when growth of P. ruminicola was arrested by shifting to acidic (pH 4.8) conditions.

Primer extension experiment revealed the three very close transcriptional start sites for recA. The putative -10 and -35 RNA polymerase binding regions were proposed on the basis of transcript mapping. These regions bear very little similarity to the E. coli (sigma70) and B. subtilis (sigmaA) consensus sequences, as well as to the recognition sites of other minor sigma-factors.

Transcript mapping experiments in E. coli expressing P. ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription. Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative -10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P. ruminicola.

This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E. coli and other Gram-negative bacteria.